p ampk 200 monoclonal cell signaling technology (Cell Signaling Technology Inc)
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
98
Structured Review
Cell Signaling Technology Inc
p ampk 200 monoclonal cell signaling technology
P Ampk 200 Monoclonal Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 5418 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ampk+cell+signaling+technology/Phospho-AMPKalpha+(Thr172)+Rabbit+mAb/us12578341-108-30-33
Average 98 stars, based on 5418 article reviews
P Ampk 200 Monoclonal Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 5418 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ampk+cell+signaling+technology/Phospho-AMPKalpha+(Thr172)+Rabbit+mAb/us12578341-108-30-33
Average 98 stars, based on 5418 article reviews
p ampk 200 monoclonal cell signaling technology - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
other:Article Title: RIPK1 regulates starvation resistance by modulating aspartate catabolism Article Snippet: Name Source Product No. Dilution Rabbit anti Article Title: The essential role of adenine nucleotide translocase 4 on male reproductive function in mice Article Snippet: Protein name Manufacturer (catalogue number) Applications (working dilution) ANT4 Biorbyt (orb215309) 1:1000 β-TUBLIN Santa Cruz Blotechnology (5274) 1:5000 LC3B Proteintech (18725-1-AP) 1:1000 Article Title: Effects of hypercaloric diet-induced hyperinsulinemia and hyperlipidemia on the ovarian follicular development in mice Article Snippet: Article Title: PACAP–Sirtuin3 alleviates cognitive impairment through autophagy in Alzheimer’s disease Article Snippet: ATG5 Forward GCTTTTGCCAAGAGTCAGCTAT Reverse AACCAATTGGATAATGCCATTTCAG Beclin1 Forward AGGAACTCACAGCTCCATTACT Reverse CTCTCCTGAGTTAGCCTCTTCC GAPDH Forward GACCCCTTCATTGACCTCAAC Reverse TTCTCCATGGTGGTGAAGA Supplementary Table S2 Antibodies used in western blot Target Supplier Catalog Number Concentration Aβ1-16 Biolegend 803001 1: 1000 Tau-5 BD Biosciences 556319 1: 1000 PACAP Invitrogen ZP006 1: 1000 Article Title: Effects of hypercaloric diet-induced hyperinsulinemia and hyperlipidemia on the ovarian follicular development in mice Article Snippet: Article Title: Tomatidine-stimulated maturation of human embryonic stem cell-derived cardiomyocytes for modeling mitochondrial dysfunction Article Snippet: List of primary antibodies used in this study 2 Antibody Supplier Catalog number Host Dilution GAPDH Santa Cruz Biotechnology SC-47724 Mouse 1:2000 α-SA Sigma-Aldrich A7732 Mouse 1:2000 cTnT Abcam Ab45932 Rabbit 1:5000 MLC2a Synaptic Systems GmbH 311 011 Mouse 1:500 MLC2v Thermofisher Scientific 10906-1-ap Rabbit 1:500 cTnI Abcam Ab47003 Rabbit 1:2000 BIN1 Abcam Ab185950 Rabbit 1:500 JPH2 Biorbyt Orb13188 Mouse 1:250 Western Blot:Article Title: Tcf7l2 in hepatocytes regulates de novo lipogenesis in diet-induced non-alcoholic fatty liver disease in mice Article Snippet: .. Antibodies used for Western blotting, Immunoprecipitation and Chromatin immunoprecipitation ANTIBODY SOURCE IDENTIFIER Dilution TCF4/TCF7L2 (C48H11) Cell signaling Technology Cat# 2569 1:1000 HSP90/(H-114) Santa Cruz Cat# sc-7947 1:5000 Akt Cell signaling technology Cat# 9272 1:1000 Phospho-Akt (Ser473) Cell signaling technology Cat# 9271 1:1000 GSK3(27c10) Cell signaling technology Cat# 9315 1:1000 Phospho-GSK3Ser9) Cell signaling technology Cat# 9336 1:1000 ACC (C83B10) Cell signaling technology Cat# 3676 1:3000 FAS (C20G5) Cell signaling technology Cat#3180 1:3000 SREBP1 BD Biosciences Cat#557036 1:1000 ChREBP NOVUS Cat# NB400-135 1:1000 PKLR (E-2) (referred to as ‘L-PK’ in Figure) Santa Cruz Cat# sc-133222 1:1000 Monoclonal ANTI-FLAG M2 (referred to as ‘FLAG’ in Figure) Sigma Aldrich Cat# F3165 1:3000 HA-probe Santa Cruz Cat# Sc-7392 1:3000 Mono-and polyubiquitinylated conjugates monoclonal antibody (FK2) Enzo Life Sciences Cat# BMLPW0150-0100 1:3000 Immunoprecipitation:Article Title: Tcf7l2 in hepatocytes regulates de novo lipogenesis in diet-induced non-alcoholic fatty liver disease in mice Article Snippet: .. Antibodies used for Western blotting, Immunoprecipitation and Chromatin immunoprecipitation ANTIBODY SOURCE IDENTIFIER Dilution TCF4/TCF7L2 (C48H11) Cell signaling Technology Cat# 2569 1:1000 HSP90/(H-114) Santa Cruz Cat# sc-7947 1:5000 Akt Cell signaling technology Cat# 9272 1:1000 Phospho-Akt (Ser473) Cell signaling technology Cat# 9271 1:1000 GSK3(27c10) Cell signaling technology Cat# 9315 1:1000 Phospho-GSK3Ser9) Cell signaling technology Cat# 9336 1:1000 ACC (C83B10) Cell signaling technology Cat# 3676 1:3000 FAS (C20G5) Cell signaling technology Cat#3180 1:3000 SREBP1 BD Biosciences Cat#557036 1:1000 ChREBP NOVUS Cat# NB400-135 1:1000 PKLR (E-2) (referred to as ‘L-PK’ in Figure) Santa Cruz Cat# sc-133222 1:1000 Monoclonal ANTI-FLAG M2 (referred to as ‘FLAG’ in Figure) Sigma Aldrich Cat# F3165 1:3000 HA-probe Santa Cruz Cat# Sc-7392 1:3000 Mono-and polyubiquitinylated conjugates monoclonal antibody (FK2) Enzo Life Sciences Cat# BMLPW0150-0100 1:3000 Chromatin Immunoprecipitation:Article Title: Tcf7l2 in hepatocytes regulates de novo lipogenesis in diet-induced non-alcoholic fatty liver disease in mice Article Snippet: .. Antibodies used for Western blotting, Immunoprecipitation and Chromatin immunoprecipitation ANTIBODY SOURCE IDENTIFIER Dilution TCF4/TCF7L2 (C48H11) Cell signaling Technology Cat# 2569 1:1000 HSP90/(H-114) Santa Cruz Cat# sc-7947 1:5000 Akt Cell signaling technology Cat# 9272 1:1000 Phospho-Akt (Ser473) Cell signaling technology Cat# 9271 1:1000 GSK3(27c10) Cell signaling technology Cat# 9315 1:1000 Phospho-GSK3Ser9) Cell signaling technology Cat# 9336 1:1000 ACC (C83B10) Cell signaling technology Cat# 3676 1:3000 FAS (C20G5) Cell signaling technology Cat#3180 1:3000 SREBP1 BD Biosciences Cat#557036 1:1000 ChREBP NOVUS Cat# NB400-135 1:1000 PKLR (E-2) (referred to as ‘L-PK’ in Figure) Santa Cruz Cat# sc-133222 1:1000 Monoclonal ANTI-FLAG M2 (referred to as ‘FLAG’ in Figure) Sigma Aldrich Cat# F3165 1:3000 HA-probe Santa Cruz Cat# Sc-7392 1:3000 Mono-and polyubiquitinylated conjugates monoclonal antibody (FK2) Enzo Life Sciences Cat# BMLPW0150-0100 1:3000 Modification:Article Title: Korean Red Ginseng Improves Oxidative Stress-Induced Hepatic Insulin Resistance via Enhancing Mitophagy. Article Snippet: .. Dulbecco’s Modified Eagle’s Medium (DMEM), Corning®, Glendale, CA, USA; Fetal Bovine Serum (FBS), Corning®, Glendale, CA, USA; M199 medium, Corning®, Glendale, CA, USA; Penicillin-Streptomycin solution 100× (PS), Corning®, Glendale, CA, USA; TB Green Premix Ex Taq II, TAKARA, Shiga, Japan; Carbonyl Cyanide m-Chlorophenylhydrazone (CCCP), Sigma-Aldrich, St. Louis, MO, USA; Metformin hydrochloride Sigma-Aldrich, St. Louis, MO, USA; MitoSOXTM Invitrogen by Thermo Scientific, Waltham, MA, USA; Palmitic Acid, Sigma-Aldrich, St. Louis, MO, USA; LipofectamineTM 3000 Transfection Reagent Invitrogen by Thermo Scientific, Waltham, MA, USA; Primer ScriptTM RT Reagent Kit with gDNA Eraser, Shiga, Japan; BCA Protein Assay Kit, Thermo Scientific, Waltham, MA, USA; Anti-Pink1 Abclonal (A7131); Anti-Parkin Abcam (AB15494); Actin Santa Cruz (A5441); TOM40 Santa Cruz (sc-365467); TIM23 Abclonal (A8688); P62 Cell Signaling Technology, Danvers, MA, USA; LC3B Cell Signaling Technology (#3868); Tom20 Santa Cruz (sc-17764); Tom70 Santa Cruz (sc-390545); P-IRS Abcam (Ab5599); IRS Abcam (Ab131487); P-JNK Abclonal (AP0276); JNK Abclonal (A4867); p-AKT Cell Signaling Technology (4060S); AKT Cell Signaling Technology (9272S), p-AMPK Abcam (40H9), Transfection:Article Title: Korean Red Ginseng Improves Oxidative Stress-Induced Hepatic Insulin Resistance via Enhancing Mitophagy. Article Snippet: .. Dulbecco’s Modified Eagle’s Medium (DMEM), Corning®, Glendale, CA, USA; Fetal Bovine Serum (FBS), Corning®, Glendale, CA, USA; M199 medium, Corning®, Glendale, CA, USA; Penicillin-Streptomycin solution 100× (PS), Corning®, Glendale, CA, USA; TB Green Premix Ex Taq II, TAKARA, Shiga, Japan; Carbonyl Cyanide m-Chlorophenylhydrazone (CCCP), Sigma-Aldrich, St. Louis, MO, USA; Metformin hydrochloride Sigma-Aldrich, St. Louis, MO, USA; MitoSOXTM Invitrogen by Thermo Scientific, Waltham, MA, USA; Palmitic Acid, Sigma-Aldrich, St. Louis, MO, USA; LipofectamineTM 3000 Transfection Reagent Invitrogen by Thermo Scientific, Waltham, MA, USA; Primer ScriptTM RT Reagent Kit with gDNA Eraser, Shiga, Japan; BCA Protein Assay Kit, Thermo Scientific, Waltham, MA, USA; Anti-Pink1 Abclonal (A7131); Anti-Parkin Abcam (AB15494); Actin Santa Cruz (A5441); TOM40 Santa Cruz (sc-365467); TIM23 Abclonal (A8688); P62 Cell Signaling Technology, Danvers, MA, USA; LC3B Cell Signaling Technology (#3868); Tom20 Santa Cruz (sc-17764); Tom70 Santa Cruz (sc-390545); P-IRS Abcam (Ab5599); IRS Abcam (Ab131487); P-JNK Abclonal (AP0276); JNK Abclonal (A4867); p-AKT Cell Signaling Technology (4060S); AKT Cell Signaling Technology (9272S), p-AMPK Abcam (40H9), Bicinchoninic Acid Protein Assay:Article Title: Korean Red Ginseng Improves Oxidative Stress-Induced Hepatic Insulin Resistance via Enhancing Mitophagy. Article Snippet: .. Dulbecco’s Modified Eagle’s Medium (DMEM), Corning®, Glendale, CA, USA; Fetal Bovine Serum (FBS), Corning®, Glendale, CA, USA; M199 medium, Corning®, Glendale, CA, USA; Penicillin-Streptomycin solution 100× (PS), Corning®, Glendale, CA, USA; TB Green Premix Ex Taq II, TAKARA, Shiga, Japan; Carbonyl Cyanide m-Chlorophenylhydrazone (CCCP), Sigma-Aldrich, St. Louis, MO, USA; Metformin hydrochloride Sigma-Aldrich, St. Louis, MO, USA; MitoSOXTM Invitrogen by Thermo Scientific, Waltham, MA, USA; Palmitic Acid, Sigma-Aldrich, St. Louis, MO, USA; LipofectamineTM 3000 Transfection Reagent Invitrogen by Thermo Scientific, Waltham, MA, USA; Primer ScriptTM RT Reagent Kit with gDNA Eraser, Shiga, Japan; BCA Protein Assay Kit, Thermo Scientific, Waltham, MA, USA; Anti-Pink1 Abclonal (A7131); Anti-Parkin Abcam (AB15494); Actin Santa Cruz (A5441); TOM40 Santa Cruz (sc-365467); TIM23 Abclonal (A8688); P62 Cell Signaling Technology, Danvers, MA, USA; LC3B Cell Signaling Technology (#3868); Tom20 Santa Cruz (sc-17764); Tom70 Santa Cruz (sc-390545); P-IRS Abcam (Ab5599); IRS Abcam (Ab131487); P-JNK Abclonal (AP0276); JNK Abclonal (A4867); p-AKT Cell Signaling Technology (4060S); AKT Cell Signaling Technology (9272S), p-AMPK Abcam (40H9), |